Lab#3: Cladograms and Phylogenetic Analysis using BLAST, Part 3

Preparing to use the BLAST website – pre lab work

 

We will be working with this document (abercrombie_gulo_blast-and-phylogeny-lab) so you will want to print it out.

Pages 1-2:  Go ahead and make the cladogram for the plant information in that first table (exercise #1). With #2, we are finally getting to the heart of what this lab is about: making cladograms or mapping out evolutionary relationships using genomes and DNA similarities. However, the construction of the cladogram is the same, so don’t worry, we just need to adapt our thinking a little bit. DNA mapping revolutionized evolutionary theory, and turned over many long established ideas of how life on Earth was related to each other, so this is an exciting and fascinating area of research! If you think about it, using physical characteristics to map ancestral relationships is inherently limiting and error-prone, and offers very limited ways to study bacteria, protists, and other puzzles of the higher kingdoms (mammals in the ocean? Birds from dinosaurs?). And in using BLAST (more on this below), you will be using the same exact tool that scientists use every single day to map these relationships. Way cool, dudes 🙂

Back to the document – GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) question. Go ahead and make the cladogram and answer the questions. Don’t forget to specify an outgroup.

Pages 2 – 4:  The GULO activity ( labelled “Searching or Fossil Genes”)

What is the BLAST program? Well, it is a website that stores mapped genome data from all life forms in one place and allows scientists (and students) to enter in genomic data and compare it to any known genetic data in the database. Here’s the link:

https://blast.ncbi.nlm.nih.gov/Blast.cgi

Now, it is a VERY confusing albeit incredible website, and this lab is not to learn all about BLAST and be able to use it on your own. The lab will walk you through using BLAST step by step and there won’t be BLAST specific questions on the AP exam. The lab is about learning how to construct evolutionary trees using genetic data, and BLAST allows us to compare genetic sequences between a variety of sources.

Part A of GULO Activity.

So, read through the GULO story.

Use the document (pages 3-4) to work through your first BLAST comparison. I’ve copied the mouse DNA sequence below if it is difficult to copy and paste from the Adobe PDF. I’ve also copied the instructions and annotated it with my comments so it is crystal clear.

> mouse gulo gene CDS
ATGGTCCATGGGTACAAAGGGGTCCAGTTCCAAAACTGGGCGAAGACCTATGGCTGCAGTCCAG
AGATGTACTACCAGCCCACATCAGTGGGGGAGGTCAGAGAGGTGCTGGCCCTGGCCCGGCAGC
AGAACAAGAAAGTGAAGGTGGTGGGTGGCGGCCACTCGCCTTCAGACATCGCCTGCACCGATG
GCTTCATGATTCACATGGGCAAGATGAACCGGGTTCTCCAGGTGGACAAGGAGAAGAAGCAGG
TCACAGTGGAAGCCGGTATCCTCCTGACTGACCTGCACCCACAGCTGGACAAGCATGGCCTGGC
CCTGTCTAATCTGGGAGCCGTGTCTGATGTGACGGTTGGTGGCGTCATTGGGTCTGGAACACATA
ACACCGGGATCAAGCACGGTATCCTGGCCACCCAGGTGGTGGCCCTGACCCTGATGAAGGCTGT
GGAACAGTTCTGGAATGTTCTGAGTCAAGTAATGCAGATGTGTTCCAGGCTGCAAGGGTGCACC
TGGGCTGCCTGGGTGTTATCCTCACTGTCACCCTGCAGTGTGTGCCACAGTTCCACCTTCTGGAG
ACATCCTTTCCTTCGACCCTCAAGGAGGTCCTTGACAACCTGGACAGCCACCTGAAGAAGTCTG
AGTACTTCCGCTTCCTCTGGTTTCCTCACAGTGAGAACGTCAGCATCATCTACCAAGATCACACC
AACAAGGAGCCCTCCTCTGCATCTAACTGGTTTTGGGACTATGCCATTGGGTTCTACCTCCTGGA
ATTCTTGCTCTGGACCAGCACCTACCTGCCACGCCTCGTGGGCTGGATCAACCGCTTCTTCTTCT
GGCTGCTGTTCAACTGCAAGAAGGAGAGCAGCAACCTCAGCCACAAGATCTTCTCCTACGAGTG
TCGCTTCAAGCAGCATGTCCAAGACTGGGCCATCCCCAGGGAGAAGACCAAGGAGGCCCTGCTG
GAGCTAAAGGCCATGCTGGAGGCCCACCCCAAGGTGGTAGCCCACTACCCCGTGGAGGTGCGCT
TCACCCGAGGTGATGACATCCTGCTGAGCCCGTGCTTCCAGAGGGACAGCTGCTACATGAACAT
CATTATGTACAGGCCCTATGGGAAGGATGTGCCTCGGTTGGATTACTGGCTGGCCTATGAGACC
ATCATGAAGAAGTTTGGAGGCAGGCCCCACTGGGCAAAGGCCCACAATTGCACCAGGAAGGAC
TTTGAGAAAATGTACCCCGCCTTTCACAAGTTCTGTGACATCCGCGAGAAGCTGGACCCCACTG
GAATGTTCTTGAATTCGTACCTGGAAAAGGTTTTCTACTAA

2.    On the internet, go to www.ncbi.nlm.nih.gov.
3.    From the menu at the top of the page, select BLAST (Under the “Resources” tab >> DNA&RNA >> BLAST, the first listing).
4.    Now on the BLAST page, select “nucleotide BLAST”. It is in a large box on the page under Web BLAST (used to be a menu).
5.    Copy the mouse GULO sequence into the box under “Enter Query Sequence”.
6.    Scroll down until you see “Database”.
7.    Check the “Others” box. Change the database setting in the box to “nucleotide collection” (should all be selected already).
8.    In the “Organism” window, type in “cow”. When you see cow appear in the box, select it (it will be the first listing).
9.    Scroll to the bottom and find the “BLAST” button. Above the “BLAST” button, you will see the “optimize for” box. Select optimize for “somewhat similar sequences(BLASTn)”.

10.    Scroll back down and hit the “BLAST” button.
11.    When BLAST is done with its search (you will get an interim page while it is working), you can scroll down and see a colorized diagram indicating the degree of similarity of the BLAST hits to your mouse GULO nucleotide sequence. Red and pink/purple mean a good match, while green, blue and black indicate a poor match. If the colored line spans the entire length of the window, then the “hit” sequence matches the inquiry sequence along its entire length. We want to see a high quality match along a majority of the inquiry sequence.

12.    Below the colorized diagram is a “hit list” of your results.  This shows the quality of matching as an E-­‐value. An E-­‐value is the chance that the matchup may be due to a random matching of a sequence of bases. The smaller the E-­‐value, the more confidence you can have in your matching. A good match should have a low E-­‐ value (red or pink line) and an alignment along a large segment of the sequence.
13.    Note your result in the chart below ( you want to write down the E-value and the query coverage. These vales are both in the Descriptions section).
14.    Now start again and do BLAST searches for pig (Sus scrufa), human (Homo sapiens), cow (Bos taurus), guinea pig (Cavia porcellus), and chimpanzee (Pan troglodytes) GULO genes. Record your data in the chart. Note the entries for “mouse” in the chart will be perfect because that is our comparison sequence.

NOTE: BLAST has changed their formatting so I found this document howto_use_new_blast_formatting_return_to_old_view from CollegeBoard to help if you need more explanation.

When you are finished, you should have this table filled out – I did the cow line for you.
making_tables_1

Leave a Comment